variant 

A variant needs to be included for a sequence if consensus-sequence-block 
        doesn't match a known database, meaning there is some ambiguity in the 
        submitted sequence of nucleotide bases.

        Children:
        --------
        - variant-effect: (optional) Effect of this variation from the published 
                          sequence.

        Attribute:
        ---------  
        - id:
        - name:
        - start:           Variant sequence start position - ('0' based).
        - end:             Variant sequence end position.
        - reference-bases: The nucleotide bases from which the reported sequence
                           differs. (required, A/G/C/T string)
        - alternate-bases: The nucleotide bases to substitute for the reported 
                           sequence. (required, A/G/C/T string)
        - quality-score:   Quality of the variant (optional).
        - filter:          Values 'PASS' or 'FAIL' as used in VCF format.
        - uri:             External reference for this variant.

Element Information

Model

variant-effect*
Children: variant-effect

Attributes

QName Type Fixed Default Use Inheritable Annotation
alternate-bases simple-bases required
end position-type required
filter restriction of xs:string optional
id restriction of xs:string optional
name restriction of xs:string optional
quality-score quality optional
reference-bases simple-bases required
start position-type required
uri xs:anyURI optional
Wildcard: ANY attribute from ANY namespace

Used By

Element consensus-sequence-block

Source 

<xs:element name="variant">
  <xs:annotation>
    <xs:documentation>A variant needs to be included for a sequence if consensus-sequence-block doesn't match a known database, meaning there is some ambiguity in the submitted sequence of nucleotide bases. Children: -------- - variant-effect: (optional) Effect of this variation from the published sequence. Attribute: --------- - id: - name: - start: Variant sequence start position - ('0' based). - end: Variant sequence end position. - reference-bases: The nucleotide bases from which the reported sequence differs. (required, A/G/C/T string) - alternate-bases: The nucleotide bases to substitute for the reported sequence. (required, A/G/C/T string) - quality-score: Quality of the variant (optional). - filter: Values 'PASS' or 'FAIL' as used in VCF format. - uri: External reference for this variant.</xs:documentation>
  </xs:annotation>
  <xs:complexType>
    <xs:sequence>
      <xs:element ref="variant-effect" minOccurs="0" maxOccurs="unbounded"/>
    </xs:sequence>
    <xs:attribute name="id" use="optional">
      <xs:simpleType>
        <xs:restriction base="xs:string">
          <xs:minLength value="1"/>
        </xs:restriction>
      </xs:simpleType>
    </xs:attribute>
    <xs:attribute name="name" use="optional">
      <xs:simpleType>
        <xs:restriction base="xs:string">
          <xs:minLength value="1"/>
        </xs:restriction>
      </xs:simpleType>
    </xs:attribute>
    <xs:attribute name="start" type="hmlns:position-type" use="required"/>
    <xs:attribute name="end" type="hmlns:position-type" use="required"/>
    <xs:attribute name="reference-bases" type="hmlns:simple-bases" use="required"/>
    <xs:attribute name="alternate-bases" type="hmlns:simple-bases" use="required"/>
    <xs:attribute name="quality-score" type="hmlns:quality" use="optional"/>
    <xs:attribute name="filter" use="optional">
      <xs:simpleType>
        <xs:restriction base="xs:string">
          <xs:enumeration value="PASS"/>
          <xs:enumeration value="FAIL"/>
          <xs:enumeration value="pass"/>
          <xs:enumeration value="fail"/>
        </xs:restriction>
      </xs:simpleType>
    </xs:attribute>
    <xs:attribute name="uri" type="xs:anyURI" use="optional"/>
    <xs:anyAttribute/>
  </xs:complexType>
</xs:element>

Sample

< consensus-sequence-block xmlns = "http://schemas.nmdp.org/spec/hml/1.0" reference-sequence-id = "ref1" start = "29942124" end = "29944020" strand = "1" phase-set = "1" continuity = "true" expected-copy-number = "1" description = "HLA-A exon 1" >

< sequence>

TTTCTTGGAGCAGGTTAAACATGAGTGTCATTTCTTCAACGGGACGGAGCGGGTGCGGTTCCTGGACA GATACTTCTATCACCAAGAGGAGTACGTGCGCTTCGACAGCGACGTGGGGGAGTACCGGGCGGTGACG GAGCTGGGGCGGCCTAGCGCCGAGTACTGGAACAGCCAGAAGGACCTCCTGGAGCAGAGGCGGGCCGA GGTGGACACCTACTGCAGACACAACTACGGGGTTGTGGAGAGCTTCACA

</ sequence>

< variant reference-bases = "T" alternate-bases = "C" start = "29942937" end = "29943001" >

< variant-effect term = "missense_variant" />

</ variant>

< variant reference-bases = "CG" alternate-bases = "C" start = "29942999" end = "29943025" >

< variant-effect term = "frameshift_variant" />

</ variant>

< variant reference-bases = "A" alternate-bases = "AT" start = "29942760" end = "29942852" >

< variant-effect term = "stop_gained" />

</ variant>

< sequence-quality sequence-start = "29942937" sequence-end = "29943001" quality-score = "1.0" />

< sequence-quality sequence-start = "29942955" sequence-end = "29943020" quality-score = "1.0" />

</ consensus-sequence-block>